#dna

Scientists have spliced the DNA of a human with a sea cow. Oh, the humanatee.

My daughter did a cart wheel and slammed her head right into the coffee table. That's all the DNA test I need.

Ever heard of the DNA? National Dyslexic Association.

The attorney tells the accused, ""I have some good news and some bad news."" ""What's the bad news?"" asks the accused. ""The bad news is, your blood is all over the crime scene, and the DNA tests prove you did it."" ""What's the good news?"" ""Your cholesterol is 130.""

A DNA molecule walks into a bar ""What will it be?"" asks the bartender. ""ATCGGCAGGCTTCAGTTGCA"" says the DNA molecule.

A dorito asks the doctor whether or not he's done the DNA test to his son yet.... The doctor responds, ""Yes, I'm afraid he's NACHO son.""

A man is concerned about his son... A man is very concerned about his son and goes to a doctor. ""Doctor, I'm concerned, my son has a small disfunction in his nether region"" He says. ""What might the issue be?"" ""My son has two buttholes!"" ""I'll have to do some tests with your son, we might be able to cure him via a DNA translation"" The doctor takes the son to a special room. After a few hours the doctor returns and looks concerned. ""What is it doc? Is it bad?"" ""Sir, the DNA tests just r…

I joined the DNA this week . . . The National Dyslexic Authority

Anti-Vaccinationists are the kinds of idiots to spill hot coffee on themselves then sue because they didn't know it was hot. Anti-Vaccinationists are the kinds of idiots to not look both ways when crossing the street. Anti-Vaccinationists are the kinds of idiots to not believe in global warming. Anti-Vaccinationists are the kinds of idiots to think microwaves change the DNA is foods. Anti-Vaccinationists are the kinds of idiots to go to a school and complain to the teachers when their kid is fai…

What did the DNA say to the RNA? Uracil-y structure!

My dad used to wash my mouth out with soap... But that was just to get rid of the DNA evidence.

So they were going to make a new CSI tv show in West Virginia... But they had to scrap production when they realized there were no dental records and all the DNA was the same.

What are two reasons it's so hard to solve a redneck murder? 1. The DNA all matches. 2. There are no dental records.

What do you get when you cross.... .... the DNA of a human with the DNA of a goat? Kicked out of the petting zoo.

I can't believe I got fired from my job at the DNA testing facility. After all the blood, sweat, and tears I put in.

Why is it so hard to solve homicides in Alabama? Because the DNA always matches and the dental records never exist!

Why are murders in Kentucky so hard to solve? Because there are no dental records and all the DNA matches.

Why are crimes so hard to solve in Alabama ? Because their are no dental records and all the DNA matches

Why can't they make CSI: Alabama? Because all the DNA is the same

Why aren't the police making any neo-nazi arrests in murder cases? There's no dental records and all the DNA matches

Why are redneck murders so difficult to solve? There are no dental records and all the DNA matches.

Why can't redneck murder mysteries be solved? Because all the DNA is the same and there are no dental records.

Why are redneck murders so hard to solve? Because all the DNA matches and there's no dental records.

I can't believe I got fired from my job at the DNA testing facility. After all the blood

Why are redneck murders so hard to solve? There are no dental records and all the DNA is the same.